More on masak’s p5

So, I left the benchmark code running with a couple more strings last night before I went to bed. Here are the results I got:

cataaccggcggctcgtggctttctgtagaccgaatcttcgctgtttgctctg 5.3499312 5.5914252 9.0103538 12.8984396 26.1100836
There were nobles, who made war against each other; there was the king,
who made war against the cardinal; there was Spain, which made war against the king. 9.0724477 10.4737434 12.4736412 25.980024 32.2906812

(That’s the same test as the previous post, but I re-ran it again.)

In those times panics were common, and few days passed without some city or other registering in its archives an event of this kind.
There were nobles, who made war against each other; there was the king, who made war against the cardinal; there was Spain, which made war against the king. 20.1296963 29.2432603 33.6600319 119.7950674 139.7882468

If people have suggestions for more strings to run, I’d be happy to test them, but bear in mind that the benchmark script runs each test 10 times and averages the results, so it may take some time to get results.

UPDATE: I’ve added three more tests. I also added a new and somewhat novel routine from mberends which wasn’t part of masak’s competition. First, mberends’s results on the above tests:

dna, 25.846477
dumas-1, 52.3829865
dumas-2, 208.6451586
ttacttacccaaagtagaaataagctcgtctttgagaaccgtggactggtactacctatttttagtcaaactcatgactcgcgcctagcccacatacaat 15.4340812,: 16.0729917 19.6679714 49.7325891 107.7859086 174.7841558
tttgtccctggccacgacgttctactatatgttaatgaaacgtaaggaattgcgttggccaagaaacgtccttttcacagatacccgtcgtacctgattaccgctgtagggcgctttttccggctggggcgcgcgtgtctgttggccgggccctacgtaggcctataacggaaagatttgtaccaaattctactacgagg 40.274496 64.2675568 88.9493287

(Apologies that I didn’t time all the codes for that one, but it was very obvious the others were much slower, and I needed the Linux box for $work.)

In those times panics were common, and few days passed without some city or other registering in its archives an event of this kind. There were nobles, who made war against each other; there was the king, who made war against the cardinal; there was Spain, which made war against the king.
Then, in addition to these concealed or public, secret or open wars, there were robbers, mendicants, Huguenots, wolves, and scoundrels, who made war upon everybody. The citizens always took up arms readily against thieves, wolves or scoundrels, often against nobles or Huguenots, sometimes against the king, but never against cardinal or Spain. It resulted, then, from this habit that on the said first Monday of April, 1625, the citizens, on hearing the clamor, and seeing neither the red-and-yellow standard nor the livery of the Duc de Richelieu, rushed toward the hostel of the Jolly Miller. When arrived there, the cause of the hubbub was apparent to all. 167.9458936 467.1575598 858.1724499 2079.24607 3054.501836 4872.900568

4 Responses to “More on masak’s p5”

  1. Aaron Sherman Says:

    It would be nice if you could link to mberends solution. I’ve got one myself that seems to perform better than any of your examples under certain circumstances, but it’s impossible to tell without running my own trials…

  2. Aaron Sherman Says:

    So, it looks like my solution doesn’t beat colomon’s for all inputs (it does on the very long English text given above), but it does beat everyone else, and it’s radically simpler than colomon’s solution. I’ll post it when I have a chance, but the algorithm is pretty trivial I just keep two lists: known solutions and “active” solutions. An active solution is any sub-string that I’ve encountered in both source strings, but which might only be the root of a longer solution. I walk forward from 0 to whichever string length is larger (i, below) and do 8 things (there’s a lot of bounds checking in my code that I’m ignoring, below):

    0) Store the current position, i, in both strings as an “active solution” of length 0 (an active solution is a datastructure containing an offset in string1, an offset in string2 and a current length).

    1) check to see if string1[i] eq string2[x] where x is set to the last tested string2 position in each active solution plus one, if so increment its length by 1.

    2) Same as above, but testing string2[i] against active solutions

    3) At this point, all active solutions not matched in steps 1 or 2, above are removed from the list of active solutions and added to known solutions.

    4) For all positions in string2 which are saved in the lookup table (see below) under string1[i], store a new, active solution of length 1.

    5) Same as #4, but reversing string1/string2.

    6) Append the index i to the list at lookup1[string1[i]]

    7) as #6, but save to lookup2[string2[i]]

    Once done with the outer loop, return the longest known solution.

    Practical concerns include the fact that this approach could be memory intensive for very large strings.

    • Aaron Sherman Says:

      Since I fixed a small bug (code uploaded here ) I’m no longer beating colomon. However, I am still producing very reasonable times, and beating most of the other contenders for most of the inputs. My worst performance is on inputs that have low numbers of symbols (e.g. the genetics examples), and I shine best on English text.

  3. Martin Berends Says:

    Aaron, this is with the disclaimer that it is not being developed to be competitive and is hobbled by poor chr(0) handling in regexes and strings. It would be a helpful yak shave to remove the workarounds (after eliminating the need for them) and then compare performance. I made a Perl 5 version without workarounds and it runs much faster, but that may just be Perl 5.

Leave a Reply

Fill in your details below or click an icon to log in: Logo

You are commenting using your account. Log Out /  Change )

Google+ photo

You are commenting using your Google+ account. Log Out /  Change )

Twitter picture

You are commenting using your Twitter account. Log Out /  Change )

Facebook photo

You are commenting using your Facebook account. Log Out /  Change )


Connecting to %s

%d bloggers like this: